Mephitic Rise

title-bloqmephitic-rise3mephitic-rise4mephitic-rise5mephitic-rise6mephitic-rise7mephitic-rise8mephitic-rise9mephitic-rise10mephitic-rise11mephitic-rise12

ZIKA Statistics

Florida has confirmed that local transmission of Zika virus is occurring in two areas in Miami-Dade County. One area is about 4.5 square miles in Miami Beach within the boundaries of 8th and 63rd streets. The second area is about one square mile within the boundaries of NW 79th St. to the North, NW 63rd St. to the South, NW 10th Ave. to the West and N. Miami Ave to the East. Detailed maps of the two areas are below.

On Monday, September 19, the Zika zone in Wynwood, which was originally about one square mile, was lifted after 45 days with no evidence of active Zika transmission. The department advises residents and visitors in Wynwood to remain vigilant about mosquito bite protection by draining all sources of standing water to keep mosquitoes from breeding and wearing bug repellent to help keep Wynwood Zika free.

Florida’s small case cluster is not considered widespread transmission. If the department identifies additional areas of concern, we will notify the media and the public immediately.

ZIKA infection of cells

ZIKV real-time RT-PCR.Total RNA was extracted from human fibroblasts by using Tri reagent (Sigma, Saint Quentin Fallavier, France) according to the manufacturer’s protocol. The RNA pellet was resuspended in 30 μl of RNase-free distilled water and stored at 80°C. One microgram of RNA was used for reverse transcription using Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega, Charbonnieres, France) according to the manufacturer’s instructions. Maxima probe/ROX qPCR master mix (Fermentas, Saint Remy les Chevreuses, France) was used for all quantitative PCRs (qPCRs). Each 25-μl reaction mixture contained 500 nM forward primer, 500 nM reverse primer, 250 nM specific probe, and 1× (final concentration) Maxima probe/ROX qPCR master mix. The primer and probe sequences targeting ZIKV have already been described (28). Amplification in an Applied Biosystems 7300 real-time PCR system involved activation at 95°C for 10 min followed by 40 amplification cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 30 s. Real-time data were analyzed using SDS software from Applied Biosystems. Viral RNA was quantified by comparing each sample’s threshold cycle (CT) value with a ZIKV RNA standard curve, which was obtained as follows. First, total viral RNA from the cell culture was purified using a QIAamp viral RNA kit (Qiagen, Courtaboeuf, France) following the manufacturer’s protocol. A standard RT-PCR was then carried out by using primers containing the T7 promoter sequence (T7-ZIKV_F,TAATACGACTCACTATAGGGTTGGTCATGATACTGCTGATTGC; and ZIKV_R, CCTTCCACAAAGTCCCTATTGC). The PCR product was used to generate ZIKV RNA fragments by in vitro transcription using a MAXIscript kit (Ambion, Austin, TX). RNA was then purified by ethanol precipitation, and the RNA strands generated were determined by spectrophotometry and converted to numbers of molecular copies by using the following formula: number of y molecules per microliter = [(x grams per microliter of RNA)/(transcript length in base pairs × 340)] × 6.02 × 1023. RNA standards containing RNA copies were used to construct a standard curve.

 

 

 

 

 

mephitic-rise15mephitic-rise16

mephitic-rise17

 

 

 

 

mephitic-rise18mephitic-rise19

 

 

 

mephitic-rise20

 

 

 

 

 

 

mephitic-rise21

 

mephitic-rise22mephitic-rise23mephitic-rise24mephitic-rise25

 

 

printermodel

mephitic-rise26Daniel Tabet

FIU School of Architecture

Advertisements